RegulonDB RegulonDB 10.9: Gene Sequence
mngA gene sequence


Size: 1977        A: 404  T: 494  G: 591  C: 488

Fasta

 

>mngA E. coli K12. Version NC_000913.3 GI:556503834
atggtattgttttatcgggcacactggcgcgactataaaaacgatcaagtgaggatcatg
atgaatctgacgactctgacccaccgcgatgcgttgtgtctgaatgcgcgctttaccagc
cgtgaagaggccatccacgcgttgactcaacgtcttgctgctctggggaaaatttccagt
actgagcaatttctggaagaagtgtatcgccgtgaaagccttggcccgaccgccttaggt
gaagggttggctgtgccgcatggcaaaactgctgcggtaaaagaagcggcgtttgcggtc
gccacactcagcgagccgcttcagtgggaaggcgttgatggcccggaagcagttgattta
gtggtgctgctggcgattccccccaatgaagcgggtactacgcatatgcaactgctgaca
gcgctgaccacgcgccttgcggatgatgagattcgggcgcgtatacagtcggcgacgacg
cctgatgagttgctctcggcgctggatgacaagggaggcacgcaaccttctgcctctttt
tccaacgcgccaactatcgtctgcgtaacggcctgtccggcgggtattgctcacacctat
atggctgcggaatatctggaaaaagccggacgcaaactcggcgtaaatgtttacgttgaa
aaacaaggcgctaacggcattgaagggcgtttaacggcggatcaactcaatagtgcaacc
gcctgtatttttgcggctgaagtcgccatcaaggagagtgagcgttttaatggcattccc
gcgctttcagtgcctgttgccgagccgattcgccatgcagaagcgttgatccaacaagcg
cttaccctcaagcgtagcgatgagacgcgtaccgtacagcaagatacgcaaccggtgaaa
agtgtcaaaacggagctgaaacaggcactgttgagcggaatctcttttgccgtaccgttg
attgtcgcggggggcacggtgctggcggtcgcggtattactgtcgcaaatcttcgggcta
caagatctgtttaatgaagaaaactcctggctgtggatgtaccgcaagctgggcggcggg
ctgctcggaattttgatggtaccggtgctcgcggcctataccgcctattctctggcagat
aaaccggcgttagcgccaggctttgcggctggacttgccgccaacatgatcggctccggg
tttctcggcgcggtcgttggcggattgatagccggttacttgatgcgctgggtgaaaaat
cacttgcgtcttagcagtaaattcaatggattcctgactttttatctctacccggtgctc
ggtacgttgggagcgggcagtctgatgctgtttgtggtgggggaacctgtcgcctggatc
aataactcgcttaccgcctggctgaacggtctgtcaggaagtaacgcgctgttgctgggt
gccattctcggttttatgtgttcctttgaccttggagggccagtgaataaagccgcttat
gcattctgcctgggcgcaatggcgaacggcgtttacggcccgtatgccattttcgcctcc
gtcaaaatggtttcggcatttaccgtaaccgcttccacgatgctcgcaccgcgcctgttt
aaagagtttgaaattgagaccgggaaatccacctggctgttagggctggcaggtattacc
gaaggggcgatcccgatggcgattgaagatccgctgcgggttattggttcgtttgtgctg
ggctctatggtaacgggcgctattgtcggtgcgatgaatatcggcctttcgacacccggt
gccggcattttctcgctctttttacttcatgataatggcgcgggcggtgttatggcggca
attggctggtttggcgcggcattggtgggggctgcaatctcgactgcaattctcctgatg
tggcggcgtcacgcggttaagcatggcaactatctgactgatggcgtaatgccataa
              
                            

Download fasta file
RegulonDB