RegulonDB RegulonDB 10.9: Gene Sequence
mngB gene sequence


Size: 2634        A: 701  T: 633  G: 694  C: 606

Fasta

 

>mngB E. coli K12. Version NC_000913.3 GI:556503834
atgaaagcagtatctcgcgttcacatcaccccgcatatgcactgggatcgagagtggtat
ttcaccaccgaagagtcacgtattctgctggtcaataatatggaagagatcctgtgccga
ctggaacaggacaacgaatacaaatattacgtactcgacgggcaaacggcgatcctcgaa
gattatttcgcggtgaaaccggaaaacaaagaccgtgtgaagaaacaggtagaagccggc
aagttgattatcggcccctggtatacccagaccgataccacgattgtttctgcggaatcc
atcgtccgtaatctgatgtacggaatgcgtgactgcctcgcgtttggcgagccgatgaaa
ataggttatttaccagattcctttggcatgtccgggcaactgccgcatatctacaatgga
tttggcattacccgcaccatgttctggcgcggatgttcggagcgccacggtactgataaa
accgagtttttgtggcaaagcagtgacggtagcgaagtgacggcgcaggtgctgccgctg
ggctacgccatcggtaagtacttacctgccgacgaaaacggattacgtaaacgcctcgac
agttattttgacgtgctggaaaaagcgtctgtaaccaaagagattttgctgccgaatggg
catgaccagatgccattgcagcaaaatatcttcgaagtgatggataagctacgtgagatc
taccctcaacgtaagtttgtgatgagccgctttgaagaggtatttgagaagatcgaagcg
cagcgagataatctggcaaccctgaaaggggaatttattgatggcaaatatatgcgcgtg
catcgcaccatcggttctacgcgtatggatatcaaaattgcccacgcgcgtattgaaaat
aagattgttaatctgctggaaccgctggcaacactggcctggacgttgggttttgaatac
caccacggcttgctggagaaaatgtggaaagagatcttaaaaaatcatgcccacgacagt
atcggctgctgctgtagtgacaaagttcatcgcgaaatcgtcgcccgcttcgaactggct
gaagacatggcggataatctgattcgtttctacatgcgcaaaattgccgacaacatgccg
cagagcgacgccgacaaactcgtcctgtttaacctgatgccctggccgcgtgaagaagtt
atcaacaccactgtgcggctgcgcgccagccagtttaatttgcgggacgatcgcggtcag
cctgtaccgtattttattcgccatgcccgtgagatcgatccaggcctaatcgatcggcaa
atagttcattacggtaattacgatccctttatggagtttgatatacagatcaaccagatt
gtcccttctatgggctatcgcacgctttatatcgaagcgaatcagcctggcaacgtaatt
gcggcaaaaagtgacgctgaagggatactggaaaatgctttctggcaaattgcgctcaat
gaggatggttctctgcaactggtagataaagacagcggtgtgcgctatgaccgggtattg
caaattgaagaaagctctgatgatggtgatgaatatgactattcacccgcaaaagaagag
tgggtaattaccgcagcgaacgcgaaaccgcaatgcgatattattcatgaagcctggcag
agcagggctgttatccgctatgacatggcagtgccgctcaatttgtcagaacgcagcgcc
cggcaatccactggcagagtaggggtggtgttggttgtcactcttagtcataacagcagg
cgtattgatgtggatatcaatcttgataaccaggctgacgatcatcgccttcgtgtcctg
gtccctacaccttttaacaccgacagtgttctggcagatacgcagtttggttcgctaacg
cgccccgtgaacgacagtgcaatgaacaactggcagcaagaaggctggaaagaagcgccg
gttccggtatggaatatgctcaactatgttgccttacaggaagggcgtaacggcatggct
gtctttagcgaagggttacgtgaatttgaagtcatcggtgaagagaagaaaacctttgcc
attacgttgctgcgtggcgtgggcttactgggcaaagaagatctgcttttaaggcctggg
cggccttcgggaattaaaatgccagtcccggactcacaactacgtggtctgctttcttgt
cgcctaagtttattgagttataccggtacgccaaccgccgctggtgtagctcagcaggcg
cgagcatggctgactccagtacagtgttacaacaaaatcccatgggatgtgatgaagctc
aacaaagccggattcaacgtgccggaaagttatagtttgttgaaaatgcccccagtggga
tgcctgataagcgcacttaagaaagctgaagaccgacaagaagtgattttacggctgttt
aatccggctgaatcagcaacctgtgatgcgactgttgctttcagtcgcgaggtgatttct
tgctcagaaacgatgatggatgaacacattaccaccgaggaaaatcaaggttcaaatcta
tcggggccttttttacccggccagtcacggacgttcagttaccggcttgcctga
              
                            

Download fasta file
RegulonDB