RegulonDB RegulonDB 10.8: Gene Sequence
aqpZ gene sequence


Size: 696        A: 117  T: 215  G: 209  C: 155

Fasta

 

>aqpZ E. coli K12. Version NC_000913.3 GI:556503834
atgttcagaaaattagcagctgaatgttttggtactttctggcttgtttttggtggctgt
ggtagtgctgtactggccgcaggcttcccggaattaggcattggttttgccggcgtggcg
ttggcgttcggtctgaccgttctgacgatggcctttgctgttggtcatatttctggtggt
cattttaacccggcggtcactattggtttatgggctggcggacgttttccggcaaaagaa
gtcgttggctacgtaattgcccaggttgtcggcggtattgttgcagcggcgctgctgtat
ttaattgccagtggtaaaacgggttttgacgcggcagccagcggttttgcttctaacggt
tatggcgagcattcaccaggcggttattccatgctttccgcgctggtagttgaactggta
ttgagtgcaggtttcctgttggtgatccacggcgcaaccgacaaattcgcgccggcaggt
tttgcgccgatcgctattggtctggccttaaccctgattcacttaattagtattccggtg
actaacacttctgttaacccggcgcgcagcaccgcggttgctatcttccagggcggctgg
gcattagaacaactgtggttcttctgggtggtgccaattgtcggcggcattatcggtggt
ctgatttaccggaccctgctggaaaagcgtgattaa
              
                            

Download fasta file
RegulonDB