RegulonDB RegulonDB 10.8: Gene Sequence
emrY gene sequence


Size: 1539        A: 383  T: 515  G: 339  C: 302

Fasta

 

>emrY E. coli K12. Version NC_000913.3 GI:556503834
atggcaatcactaaatcaactccggcaccattaaccggtgggacgttatggtgcgtcact
attgcattgtcattagcgacatttatgcaaatgttggattccactatttctaacgtcgca
ataccgacaatatctggctttctgggagcatcaacagacgaaggcacctgggttatcacc
tcgtttggtgtagcaaatgccattgcgatccctgttactggcaggttggcacaaagaata
ggcgaattaagattatttttactttcagtcacttttttttcgctgtcttcattaatgtgt
agcctatcgaccaatcttgatgtgctgatattttttagagtcgttcaggggttaatggcg
gggccgttaattccactgtcacagagtttattattaaggaattatccgccagaaaaaaga
acatttgctctggcattatggtcaatgaccgtgattatcgctccgatatgtgggccgata
ttgggcggttatatttgtgataactttagctggggttggatatttttaatcaatgtccct
atggggattatcgtcctgacattatgcttaaccttacttaaaggaagagaaactgagact
tcaccggtcaaaatgaatctaccaggactgaccctgttagtgctcggtgttggtggcttg
caaattatgcttgataaagggcgcgatctggattggttcaactcgagtacaataataata
ttaacagtagtatcagttatttctctgatctctttagtcatttgggagtcgacctcagag
aacccgattcttgatctcagtttgtttaagtcccgtaacttcaccattggtattgtgagt
atcacatgcgcgtatttattttactctggagcgatcgtccttatgccgcagttactccag
gaaacgatggggtataatgcgatatgggccggacttgcttatgcgcccatcggcatcatg
ccactattaatttcacctttgataggacgttatggcaacaaaatagacatgcggttgtta
gtgacatttagttttttgatgtatgcggtttgctattactggcgttctgtgacatttatg
ccaacgattgattttacaggcatcattttgccgcagttttttcagggattcgccgttgcc
tgtttctttttacccttaacaacgatttcgttttcaggcttgccagataataaatttgcc
aatgcctcgagtatgagtaatttttttcgtaccttgtcaggatcagttggtacgtcgttg
acaatgacgctgtggggacgacgcgaatcgttacaccatagtcagttgacagcaaccatc
gatcaatttaaccccgtgtttaattcatcgtcacaaattatggataaatattatggttcg
ctttcaggagttcttaatgaaattaataatgaaataacccagcagtcactttctatttct
gcaaatgagattttccgtatggcggctattgcttttatcttacttacggttttggtttgg
tttgcgaaaccgccgtttacagcgaaaggcgttgggtga
              
                            

Download fasta file
RegulonDB