RegulonDB RegulonDB 10.10: Gene Sequence
glcB gene sequence


Size: 2172        A: 545  T: 466  G: 620  C: 541

Fasta

 

>glcB E. coli K12. Version NC_000913.3 GI:556503834
atgagtcaaaccataacccagagccgtttacgcattgacgccaattttaaacgttttgtg
gatgaagaagttttaccgggaacagggctggacgctgcggcgttctggcgcaattttgat
gagatcgttcatgatctggcaccagaaaatcgtcagttgctggcagaacgcgatcgcatt
caggcagcgcttgatgagtggcatcgcagcaatccggggccggtaaaagataaagcggcc
tataaatctttcctgcgtgaactgggctacctggtgccgcaaccggagcgcgtgacggtg
gaaaccacgggcattgacagcgaaatcaccagccaggcggggccgcagctggtggttccg
gcaatgaacgcccgctacgcgctgaacgcggcgaacgctcgctggggctcactgtacgat
gcgttatacggcagcgacatcatcccgcaggaaggggcgatggtcagcggctacgatccg
caacgcggtgagcaggttatcgcctgggttcggcgtttcctcgatgaatctctaccgctg
gaaaacggcagctatcaggatgtggtggcgtttaaggtggttgataaacaattacgcatc
cagttgaaaaatggtaaagaaaccacgttacgtactccagcacagtttgtcggttaccgt
ggcgatgccgctgcgccgacctgcattttgctgaaaaataacggcctgcatattgagctg
caaatcgatgccaatgggcggattggcaaagacgatccggcgcacatcaacgatgttatc
gtcgaagctgctatcagtaccattctcgactgcgaagattcggtcgcggcggttgatgcg
gaagataaaatcctgctgtaccgcaacctgctgggcctgatgcaggggactctgcaagag
aaaatggagaaaaacggtcggcaaatcgtgcgtaaactgaatgacgatcgtcattacacc
gccgccgatggctctgaaatttctctgcacggacgctcgctgctgtttatccgcaacgtg
ggtcatttgatgaccattcctgtgatttgggacagcgaaggcaatgaaatcccggaaggc
attcttgatggcgtcatgactggcgcgattgccctctatgatttaaaagtgcagaaaaac
tcgcgcactggcagcgtctatattgtgaaaccgaaaatgcacggtccgcaggaagtggcg
ttcgccaacaaactgtttacccgcattgagacaatgctcggtatggcaccgaataccctg
aaaatgggcattatggatgaagaacgtcggacctcgctgaacttgcgtagctgtatcgct
caggcgcgcaaccgcgtggcgttcatcaataccggtttcctcgaccgtaccggcgatgaa
atgcattcggtgatggaagctggcccgatgctgcgtaaaaatcagatgaaatcgacgcct
tggatcaaagcctacgagcgtaataacgtgctttccggtctgttctgtgggctgcgcggt
aaagcgcaaattggtaaaggcatgtgggcaatgccggacctgatggcagacatgtacagc
cagaagggcgaccaactgcgtgccggggcaaacacagcctgggttccgtcaccaaccgct
gctacgctccatgcgctgcactaccaccaaaccaacgtacagagcgtacaagccaacatt
gcccagaccgagttcaatgctgaatttgaaccgctgctggacgatctgctgactattccg
gttgctgaaaacgctaactggtcggcgcaagagatccaacaagagctggataacaacgtg
caggggattctggggtacgtggtgcgctgggtggagcaggggattggttgttcaaaagtg
ccggatattcacaatgtggcgttgatggaagaccgcgcaacgctgcgtatctccagccag
catatcgccaactggttacgtcacggtattctgaccaaagaacaggtgcaggcgtcgctg
gagaatatggcgaaagtggttgatcagcaaaacgctggcgatccggcttatcgtccgatg
gcggggaatttcgctaactcgtgtgcttttaaagctgccagcgatttaatcttcctcggc
gtgaaacagccaaacggctataccgaaccgttattacacgcctggcgtttacgcgaaaaa
gaaagtcattaa
              
                            

Download fasta file
RegulonDB