RegulonDB RegulonDB 10.8: Gene Sequence
nrdE gene sequence


Size: 2145        A: 530  T: 503  G: 549  C: 563

Fasta

 

>nrdE E. coli K12. Version NC_000913.3 GI:556503834
ttggcaacgacaaccgcagaatgcctgacgcaggaaacgatggattaccacgcgctgaat
gcgatgcttaacctctacgatagcgcaggtcgcattcagttcgataaagaccgccaggcc
gttgacgcctttattgcgacgcatgtgcgtccgaacagtgtgaccttcagtagccagcag
cagcgcctgaactggctggtcaacgaaggttactatgatgaaagcgttcttaatcgctac
tctcgcgactttgtcattacgctgtttacccacgcacacaccagcggttttcgtttccag
acattcctcggggcatggaagttttacaccagctatacgttgaagacattcgacggtaaa
cgttatctggaagattttgccgatcgagtaacgatggtggcgctgacgctggcacaaggc
gatgagacgctggcgttgcaactgaccgatgaaatgctgtcaggacgctttcagccagcc
acgccaacattcctcaactgcggtaagcagcagcgcggcgaactggtttcctgttttttg
ctgcgtattgaagacaatatggagtcgattggtcgggcggtaaattccgcactgcagctg
tcgaaacgcggcggcggcgtagcatttttgctgtcgaatctgcgagaagcgggcgcgcca
attaaacgtattgaaaatcaatcttctggcgtaattccggtgatgaaaatgctggaagac
gcattttcctatgccaaccaactcggcgctcgtcagggggctggtgcagtctatttacat
gctcatcatcccgatattctgcgttttctcgacacgaaacgggaaaatgccgacgaaaaa
atccgcattaaaacactgtcgcttggcgtggtgatcccggatatcactttccatctggca
aaagagaatgcgcagatggcgctgttttcgccttatgacgtagagcgagtttatggcaag
ccgtttgccgatgtggccatcagccaacactatgacgaactggttgccgatgaacgcatt
cgcaaaaaatacctcaacgcccgtgatttcttccagcgactggcagaaatccagtttgag
tccggctatccctacatcatgtatgaagacacggtaaaccgtgctaaccctatcgccggg
cgcataaatatgagtaatctctgctcagaaattttgcaggttaacagcgcctcagagtat
gacgagaatctcgactatacccgcacaggccatgatatttcctgcaatttaggttcgttg
aatattgcgcacaccatggattcccccgattttgcccgcacggtagagactgccgtgcgc
ggtttaacggcagtatcagatatgagtcatatccgcagcgtgccgtccatcgaagccgga
aatgccgcctcgcacgccatcggactggggcagatgaatttacacggctatctggcgcga
gaaggcatcgcttatggttcgccggaagcactggatttcaccaatctctatttctatgcc
atcacctggcatgcactgcgtacctcgatgttgctggcacgcgaacgcggtgaaaccttc
gccgggttcaaacagtcacgctatgccagtggtgaatattttagccaatatctgcaaggg
aactggcagccgaaaacggcgaaagttggcgaactgtttacccgtagcggtattacgtta
cctacccgtgagatgtgggcgcagctgcgcgacgacgtgatgcgctacggcatatacaac
cagaatcttcaggcggtgccgccaaccggttctatctcttatatcaaccatgctacgtcg
agtattcatccgattgtggcgaaagtagagatacgcaaagagggcaaaacaggacgcgtt
tactaccctgccccgtttatgactaacgagaatctggcgctgtatcaggacgcttacgaa
attggcgcagaaaagatcatcgacacctacgcggaagcgactcgccatgtcgatcagggg
ctgtcgctgacgctttttttccccgataccgccaccactcgcgatatcaacaaagcgcag
atttacgcctggcgcaagggtatcaaaacgctctattacatccgcctgcgtcagatggcg
ctggaaggcactgaaattgaaggctgcgtctcctgtgcactttaa
              
                            

Download fasta file
RegulonDB