RegulonDB RegulonDB 10.8: Gene Sequence
argZ gene sequence


Size: 77        A: 17  T: 14  G: 23  C: 23

Fasta

 

>argZ E. coli K12. Version NC_000913.3 GI:556503834
gcatccgtagctcagctggatagagtactcggctacgaaccgagcggtcggaggttcgaa
tcctcccggatgcacca
              
                            

Download fasta file
RegulonDB