RegulonDB RegulonDB 11.1: Gene Sequence
leuW gene sequence


Size: 85        A: 17  T: 17  G: 28  C: 23

Fasta

 

>leuW E. coli K12. Version NC_000913.3 GI:556503834
gcgggagtggcgaaattggtagacgcaccagatttaggttctggcgccgcaaggtgtgcg
agttcaagtctcgcctcccgcacca
              
                            

Download fasta file
RegulonDB