RegulonDB RegulonDB 10.8: Gene Sequence
serV gene sequence


Size: 93        A: 18  T: 15  G: 32  C: 28

Fasta

 

>serV E. coli K12. Version NC_000913.3 GI:556503834
ggtgaggtggccgagaggctgaaggcgctcccctgctaagggagtatgcggtcaaaagct
gcatccggggttcgaatccccgcctcaccgcca
              
                            

Download fasta file
RegulonDB