RegulonDB RegulonDB 10.10: Gene Sequence
thrV gene sequence


Size: 76        A: 15  T: 18  G: 24  C: 19

Fasta

 

>thrV E. coli K12. Version NC_000913.3 GI:556503834
gctgatatggctcagttggtagagcgcacccttggtaagggtgaggtccccagttcgact
ctgggtatcagcacca
              
                            

Download fasta file
RegulonDB