RegulonDB RegulonDB 10.8: Gene Sequence
valX gene sequence


Size: 76        A: 15  T: 14  G: 24  C: 23

Fasta

 

>valX E. coli K12. Version NC_000913.3 GI:556503834
gggtgattagctcagctgggagagcacctcccttacaaggagggggtcggcggttcgatc
ccgtcatcacccacca
              
                            

Download fasta file
RegulonDB