RegulonDB RegulonDB 10.9: Gene Sequence
rpmA gene sequence


Size: 258        A: 72  T: 57  G: 69  C: 60

Fasta

 

>rpmA E. coli K12. Version NC_000913.3 GI:556503834
atggcacataaaaaggctggcggctccacacgtaacggtcgcgattcagaagctaaacgc
ctgggcgttaagcgtttcggtggcgaatccgttctggcgggtagcatcatcgttcgtcaa
cgtggtaccaaattccacgctggcgctaacgtaggttgcggtcgtgaccacactctgttt
gctaaagcagacggtaaagtgaaattcgaagttaaaggcccgaaaaaccgtaaatttatc
agcatcgaagctgaataa
              
                            

Download fasta file
RegulonDB