RegulonDB RegulonDB 10.9: Gene Sequence
acpP gene sequence


Size: 237        A: 71  T: 52  G: 63  C: 51

Fasta

 

>acpP E. coli K12. Version NC_000913.3 GI:556503834
atgagcactatcgaagaacgcgttaagaaaattatcggcgaacagctgggcgttaagcag
gaagaagttaccaacaatgcttctttcgttgaagacctgggcgcggattctcttgacacc
gttgagctggtaatggctctggaagaagagtttgatactgagattccggacgaagaagct
gagaaaatcaccaccgttcaggctgccattgattacatcaacggccaccaggcgtaa
              
                            

Download fasta file
RegulonDB