RegulonDB RegulonDB 11.0: Gene Sequence
rmf gene sequence


Size: 168        A: 51  T: 26  G: 53  C: 38

Fasta

 

>rmf E. coli K12. Version NC_000913.3 GI:556503834
atgaagagacaaaaacgagatcgcctggaacgggcacatcaacgtggttatcaggccggc
atcgccggacgctcaaaagaaatgtgtccctatcagacgctgaatcaaaggtcacaatgg
ctgggaggctggcgagaagccatggcggacagggtagtaatggcctga
              
                            

Download fasta file
RegulonDB