RegulonDB RegulonDB 10.10: Gene Sequence
nfsB gene sequence


Size: 654        A: 167  T: 150  G: 171  C: 166

Fasta

 

>nfsB E. coli K12. Version NC_000913.3 GI:556503834
atggatatcatttctgtcgccttaaagcgtcattccactaaggcatttgatgccagcaaa
aaacttaccccggaacaggccgagcagatcaaaacgctactgcaatacagcccatccagc
accaactcccagccgtggcattttattgttgccagcacggaagaaggtaaagcgcgtgtt
gccaaatccgctgccggtaattacgtgttcaacgagcgtaaaatgcttgatgcctcgcac
gtcgtggtgttctgtgcaaaaaccgcgatggacgatgtctggctgaagctggttgttgac
caggaagatgccgatggccgctttgccacgccggaagcgaaagccgcgaacgataaaggt
cgcaagttcttcgctgatatgcaccgtaaagatctgcatgatgatgcagagtggatggca
aaacaggtttatctcaacgtcggtaacttcctgctcggcgtggcggctctgggtctggac
gcggtacccatcgaaggttttgacgccgccatcctcgatgcagaatttggtctgaaagag
aaaggctacaccagtctggtggttgttccggtaggtcatcacagcgttgaagattttaac
gctacgctgccgaaatctcgtctgccgcaaaacatcaccttaaccgaagtgtaa
              
                            

Download fasta file
RegulonDB