RegulonDB RegulonDB 11.0: Gene Sequence
folP gene sequence


Size: 849        A: 208  T: 203  G: 233  C: 205

Fasta

 

>folP E. coli K12. Version NC_000913.3 GI:556503834
atgaaactctttgcccagggtacttcactggaccttagccatcctcacgtaatggggatc
ctcaacgtcacgcctgattccttttcggatggtggcacgcataactcgctgatagatgcg
gtgaaacatgcgaatctgatgatcaacgctggcgcgacgatcattgacgttggtggcgag
tccacgcgcccaggggcggcggaagttagcgttgaagaagagttgcaacgtgttattcct
gtggttgaggcaattgctcaacgcttcgaagtctggatctcagtcgatacatccaaacca
gaagtcatccgtgagtcagcgaaagttggcgctcacattattaatgatatccgctccctt
tccgaacctggcgctctggaggcggctgcagaaaccggtttaccggtttgtctgatgcat
atgcagggaaatccaaaaaccatgcaggaagctccgaagtatgacgatgtctttgcagaa
gtgaatcgctactttattgagcaaatagcacgttgcgagcaggcgggtatcgcaaaagag
aaattgttgctcgaccccggattcggtttcggtaaaaatctctcccataactattcatta
ctggcgcgcctggctgaatttcaccatttcaacctgccgctgttggtgggtatgtcacga
aaatcgatgattgggcagctgctgaacgtggggccgtccgagcgcctgagcggtagtctg
gcctgtgcggtcattgccgcaatgcaaggcgcgcacatcattcgtgttcatgacgtcaaa
gaaaccgtagaagcgatgcgggtggtggaagccactctgtctgcaaaggaaaacaaacgc
tatgagtaa
              
                            

Download fasta file
RegulonDB