RegulonDB RegulonDB 10.8: Gene Sequence
csrB gene sequence


Size: 369        A: 112  T: 67  G: 123  C: 67

Fasta

 

>csrB E. coli K12. Version NC_000913.3 GI:556503834
gtcgacagggagtcagacaacgaagtgaacatcaggatgatgacacttctgcaggacaca
ccaggatggtgtttcagggaaaggcttctggatgaagcgaagaggatgacgcaggacgcg
ttaaaggacacctccaggatggagaatgagaaccggtcaggatgattcggtgggtcagga
aggccagggacacttcaggatgaagtatcacatcggggtggtgtgagcaggaagcaatag
ttcaggatgaacgattggccgcaaggccagaggaaaagttgtcaaggatgagcagggagc
aacaaaagtagctggaatgctgcgaaacgaaccgggagcgctgtgaatacagtgctccct
ttttttatt
              
                            

Download fasta file
RegulonDB