RegulonDB RegulonDB 10.9: Gene Sequence
sraA gene sequence


Size: 57        A: 22  T: 12  G: 12  C: 11

Fasta

 

>sraA E. coli K12. Version NC_000913.3 GI:556503834
cattcaacgccgagaatagaggaaaaattaaaggggagataaaatcccccctttttg
              
                            

Download fasta file
RegulonDB