RegulonDB RegulonDB 10.8: Gene Sequence
C0362 gene sequence


Size: 386        A: 104  T: 106  G: 95  C: 81

Fasta

 

>C0362 E. coli K12. Version NC_000913.3 GI:556503834
aactttaagctgaaaatggcgctgtaaaaggcgccattttcatattgtagacaacgtagg
ctttgttcatgccggatgcggcgtgaacgccttatccggcatgaaaacccttcaaatcca
atagattgcagtgaacgtgtaggcctgataagcgtagcgcatcaggcaatgttgcgtttg
tcatcagtttcaaatggcgctgtaaaaggcgtcattttcatattgtagacaacgtaggct
ttgttcatgccggatgcggcgtgaacgccttatccggcatgaaaacccttcaaatccaat
agattgcagtgaacgtgtaggcctgataagcgtagcgcatcaggcaatgttgcgtttgtc
atcagttctaaatggcgctttataaa
              
                            

Download fasta file
RegulonDB