RegulonDB RegulonDB 10.8: Gene Sequence
C0465 gene sequence


Size: 78        A: 24  T: 18  G: 17  C: 19

Fasta

 

>C0465 E. coli K12. Version NC_000913.3 GI:556503834
gggaaactttattgctgatgccacccgccgcgaaattgaaataaaaaacccgatgcgcag
atcatcgggttcatttca
              
                            

Download fasta file
RegulonDB