RegulonDB RegulonDB 10.8: Gene Sequence
tpke70 gene sequence


Size: 436        A: 110  T: 109  G: 111  C: 106

Fasta

 

>tpke70 E. coli K12. Version NC_000913.3 GI:556503834
aaagccataaaaaccatgaggttattatggccgatttgaggagggaaagagtaagagcag
tttgttaaatgtacaacgacgattctcccaccgggcgcgttttaaagcgacggtggatcc
agaggtactgctccggtgcgcgcatgatctctttctcgataatcttgttcatataggcag
cggcttgattttcatctgtcgggtagccttccatctctggggtgatgaacaaacgatatc
cgctgtaatccgcttttcttaccatcgttacggtcaacatggctgcgccagagagacggg
agagaacataggtgccattggttgtggcgacattttccaccgcaaagaacggcgcgaagg
agctgcctttacgaccataatcctgatcgggagcaaaccataccgcttcacctttcttca
gtgcaccgacaatgcc
              
                            

Download fasta file
RegulonDB