RegulonDB RegulonDB 10.9: Gene Sequence
yoeB gene sequence


Size: 255        A: 79  T: 63  G: 61  C: 52

Fasta

 

>yoeB E. coli K12. Version NC_000913.3 GI:556503834
gtgaaactaatctggtctgaggaatcatgggacgattatctgtactggcaggaaacagat
aagcgaattgttaaaaagatcaatgaacttatcaaagatacccgcagaacgccatttgaa
ggtaaggggaagccagaacccctgaaacataatttgtcaggtttctggtcccgacgcatt
acagaggagcaccgtctggtatacgcggttaccgacgattcactgctcattgcagcatgt
cgttatcattattga
              
                            

Download fasta file
RegulonDB