RegulonDB RegulonDB 10.10: Gene Sequence
sroD gene sequence


Size: 86        A: 21  T: 21  G: 25  C: 19

Fasta

 

>sroD E. coli K12. Version NC_000913.3 GI:556503834
ttacgtgacgaagcgcgcggcaaagtggacaataaagcctgagcgttaagtcagtcgtca
gacgccggttaatccggcgttttttt
              
                            

Download fasta file
RegulonDB