RegulonDB RegulonDB 10.8: Gene Sequence
sroE gene sequence


Size: 92        A: 21  T: 25  G: 26  C: 20

Fasta

 

>sroE E. coli K12. Version NC_000913.3 GI:556503834
ataacgtgatgggaagcgcctcgcttcccgtgtatgattgaacccgcatggctcccgaaa
cattgagggaagcgttgagggttcatttttat
              
                            

Download fasta file
RegulonDB