RegulonDB RegulonDB 10.9: Gene Sequence
ldrA gene sequence


Size: 108        A: 23  T: 25  G: 32  C: 28

Fasta

 

>ldrA E. coli K12. Version NC_000913.3 GI:556503834
atgacgctcgcgcagtttgccatgattttctggcacgacctggcagcaccgatcctggcg
ggaattattaccgcagcgattgtcagctggtggcgtaaccggaagtaa
              
                            

Download fasta file
RegulonDB