RegulonDB RegulonDB 10.8: Gene Sequence
rttR gene sequence


Size: 171        A: 47  T: 25  G: 45  C: 54

Fasta

 

>rttR E. coli K12. Version NC_000913.3 GI:556503834
caaaagtccctgaacttcccaacgaatccgcaattaaatattctgcccatgcggggaagg
atgagaagcttcgaccaaggttcgactcgagcgccagcgagagagcgttgccgcaggcaa
cgacccgaagggcgaagcgcgcagcgctgagtaatccttcccccaccacca
              
                            

Download fasta file
RegulonDB