RegulonDB RegulonDB 10.8: Gene Sequence
hokB gene sequence


Size: 150        A: 33  T: 37  G: 38  C: 42

Fasta

 

>hokB E. coli K12. Version NC_000913.3 GI:556503834
atgaagcacaaccctctggtggtgtgtctgctcattatctgcattacgattctgacattc
acactcctgacccgacaaacgctctacgaactgcggttccgggacggtgataaggaggtt
gctgcgctcatggcctgcacgtccaggtaa
              
                            

Download fasta file
RegulonDB