RegulonDB RegulonDB 10.8: Gene Sequence
gnsA gene sequence


Size: 174        A: 72  T: 33  G: 38  C: 31

Fasta

 

>gnsA E. coli K12. Version NC_000913.3 GI:556503834
gtgaatattgaagagttaaaaaaacaagccgaaacggaaatcgccgactttatcgcgcaa
aaaatcgccgagctgaacaagaatacagggaaagaagtctctgaaattcgcttcaccgca
cgagaaaaaatgaccgggcttgaaagttatgatgtcaaaatcaaaataatgtga
              
                            

Download fasta file
RegulonDB