RegulonDB RegulonDB 10.8: Gene Sequence
insA1 gene sequence


Size: 276        A: 65  T: 65  G: 66  C: 80

Fasta

 

>insA-1 E. coli K12. Version NC_000913.3 GI:556503834
gtggcttctgtttctatcagctgtccctcctgttcagctactgacggggtggtgcgtaac
ggcaaaagcaccgccggacatcagcgctatctctgctctcactgccgtaaaacatggcaa
ctgcagttcacttacaccgcttctcaacccggtacgcaccagaaaatcattgatatggcc
atgaatggcgttggatgccgggcaacagcccgcattatgggcgttggcctcaacacgatt
ttacgtcacttaaaaaactcaggccgcagtcggtaa
              
                            

Download fasta file
RegulonDB