RegulonDB RegulonDB 10.9: Gene Sequence
bamA gene sequence


Size: 2433        A: 606  T: 594  G: 647  C: 586

Fasta

 

>bamA E. coli K12. Version NC_000913.3 GI:556503834
atggcgatgaaaaagttgctcatagcgtcgctgctgtttagcagcgccaccgtatacggt
gctgaagggttcgtagtgaaagatattcatttcgaaggccttcagcgtgtcgccgttggt
gcggccctcctcagtatgccggtgcgcacaggcgacacggttaatgatgaagatatcagt
aataccattcgcgctctgtttgctaccggcaactttgaggatgttcgcgtccttcgtgat
ggtgatacccttctggttcaggtaaaagaacgtccgaccattgccagcattactttctcc
ggtaacaaatcggtgaaagatgacatgctgaagcaaaacctcgaggcttctggtgtgcgt
gtgggcgaatccctcgatcgcaccaccattgccgatatcgagaaaggtctggaagacttc
tactacagcgtcggtaaatatagcgccagcgtaaaagctgtcgtgaccccgctgccgcgc
aaccgtgttgacctaaaactggtgttccaggaaggtgtgtcagctgaaatccagcaaatt
aacattgttggtaaccatgctttcaccaccgacgaactgatctctcatttccaactgcgt
gacgaagtgccgtggtggaacgtggtaggcgatcgtaaataccagaaacagaaactggcg
ggcgaccttgaaaccctgcgcagctactatctggatcgcggttatgcccgtttcaacatc
gactctacccaggtcagtctgacgccagataaaaaaggtatttacgtcacggtgaacatc
accgaaggcgatcagtacaagctttctggcgttgaagtgagcggcaaccttgccgggcac
tccgctgaaattgagcagctgactaagatcgagccgggtgagctgtataacggcaccaaa
gtgaccaagatggaagatgacatcaaaaagcttctcggtcgctatggttatgcctatccg
cgcgtacagtcgatgcccgaaattaacgatgccgacaaaaccgttaaattacgtgtgaac
gttgatgcgggtaaccgtttctacgtgcgtaagatccgttttgaaggtaacgatacctcg
aaagatgccgtcctgcgtcgcgaaatgcgtcagatggaaggtgcatggctggggagcgat
ctggtcgatcagggtaaggagcgtctgaatcgtctgggcttctttgaaactgtcgatacc
gatacccaacgtgttccgggtagcccggaccaggttgatgtcgtctacaaggtaaaagag
cgcaacaccggtagcttcaactttggtattggttacggtactgaaagtggcgtgagcttc
caggctggtgtgcagcaggataactggttaggtacaggttatgctgttggtatcaacggg
accaaaaacgattaccagacctatgctgaactgtcggtaaccaacccgtacttcaccgta
gatggcgtaagcctcggtggtcgtctcttctataatgacttccaggcagatgacgccgac
ctgtccgactataccaacaagagttatggtacagacgtgacgttgggcttcccgattaac
gaatataactcgctgcgtgcaggtctgggttatgtacataactccctgtccaacatgcag
cctcaggttgcgatgtggcgttatctgtactctatgggtgaacatccgagcacctctgat
caggataacagcttcaaaacggacgacttcacgttcaactatggttggacctataacaag
cttgaccgtggttacttcccgacagatggttcacgtgtcaacctgaccggtaaagtgacc
attcctggatcggataacgaatactacaaagtgacgttagacacggcgacttatgtgccg
atcgatgacgatcacaaatgggttgttctggggcgtacccgctggggttatggtgatggt
ttaggcggcaaagagatgccgttctacgagaacttctatgccggtggttccagcaccgtg
cgtggcttccagtccaataccattggtccgaaagcagtttacttcccgcatcaggccagt
aattatgatccggactatgattacgaatgtgcgactcaggacggcgcgaaagacctgtgt
aaatcggatgatgctgtaggcggtaacgccatggcggttgccagcctcgagttcatcacc
ccgacgccgtttattagcgataagtatgctaactcggttcgtacttccttcttctgggat
atgggtaccgtttgggatacaaactgggattccagccaatattctggatatccggactat
agtgatccaagcaatatccgtatgtctgcgggtatcgcattacaatggatgtccccattg
gggccgttggtgttctcctacgcccagccgttcaaaaagtacgatggagacaaggcagaa
cagttccagtttaacatcggtaaaacctggtaa
              
                            

Download fasta file
RegulonDB