RegulonDB RegulonDB 10.8: Gene Sequence
ldtF gene sequence


Size: 741        A: 199  T: 183  G: 180  C: 179

Fasta

 

>ldtF E. coli K12. Version NC_000913.3 GI:556503834
atgcgtaaaatcgcattaattcttgcgatgttgttgatcccgtgcgtttcatttgccggt
ttgctgggcagcagtagctctaccacgcctgtgagcaaagagtataagcagcagttgatg
ggatcccctgtctacatccagatcttcaaggaagaacgtacgctcgatctctacgtcaaa
atgggcgagcaatatcaactgctcgacagctataaaatctgtaaatattccggcggctta
gggccaaaacagcgtcagggcgatttcaaaagcccggaagggttttatagcgtccagcgt
aatcagttaaaaccagacagccgttactacaaagcgattaatattggtttccccaatgcc
tatgaccgtgcgcatggttatgaagggaaatacctgatgatccacggcgattgtgtttcc
atcggctgctacgcaatgaccaatcagggtattgatgagatattccagttcgttactggt
gcgctggtgtttggtcagccgagcgtgcaagtgagtatttacccgttccgcatgaccgac
gccaatatgaagcgccataaatattccaactttaaggacttctgggagcaactgaagccg
ggttacgactactttgagcaaacccgtaagccaccaaccgtttctgtggtcaatggtcgt
tacgtggtcagcaagccgttaagccacgaagttgtgcagccacaactggcatcaaactac
acgctccccgaggcaaaataa
              
                            

Download fasta file
RegulonDB