RegulonDB RegulonDB 10.10: Gene Sequence
insN gene sequence


Size: 1913        A: 592  T: 409  G: 472  C: 440

Fasta

 

>insN E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaagaaatttcagcgcagagtttaaacgcgaatccgctcaactggtcgttgac
cagaactacaccgtggcagatgcagccagcgctatggatgtcggcctttccacaatgacg
cgatgggtgaaacaattacgtgatgaacggcagggcaaaacaccaaaagcctcccccatt
accccggaacaaattgaaatccgtgagctcaggaaaaagctacaacgtattgaaatggaa
aatgaaatattaaaaaaggctaccgcgctcttgatgtcagactccctgaacagttctcga
taatcgggaaactcagggcgcgttatcctgtggccactctctgccatgtgttcggggttc
atcgcagcagctacaaatactggaaaaaccgtcctgaaaagccagacggcagacgggctg
tattacgcagtcaggtacttgaactgcatggcatcagccacggctctgccggagcaagaa
gcatcgccacaatggcaacccagagaggataccagatggggcgctggcttgctggcagac
tcatgaaagagctggggctggtcagttgccagcagccgactcaccggtataagcgtggcg
gtcatgagcacgttgctatcccgaatcatcttgagcgacagttcgccgtaacggaaccaa
atcaggtgtggtgcggtgatgtgacctata
              
                            

Download fasta file
RegulonDB