RegulonDB RegulonDB 10.8: Gene Sequence
rclC gene sequence


Size: 594        A: 157  T: 170  G: 143  C: 124

Fasta

 

>rclC E. coli K12. Version NC_000913.3 GI:556503834
atggaaaaatacctgcacctgttaagtcggggagataaaattggcctgacattgattcgt
ctgagtattgcaattgtttttatgtggattgggttattaaagtttgtcccttacgaggca
gacagcattacaccattcgtcgcaaacagtccactaatgtcgttcttttatgaacacccg
gaagactataaacagtatctgactcacgaaggcgaatacaaaccagaagcaagggcatgg
caaacggccaataatacctatggtttttccaacggtcttggcgtcgtggaggtgattatt
gctctgctggttttggctaatcctgtcaatcgctggttaggtttattgggaggactgatg
gcatttaccacgccgctggtaacactctcatttttaatcaccaccccggaggcatgggta
cccgcattgggtgacgctcatcatggtttcccttatttatccggtgctggtcgcctggta
ttgaaagatactctgatgctggcaggtgcagtcatgataatggcagattcggcgcgggaa
attcttaaacaacgcagtaatgaatccagttcaacgttaaaaactgaatattga
              
                            

Download fasta file
RegulonDB