RegulonDB RegulonDB 10.8: Gene Sequence
yahB gene sequence


Size: 933        A: 235  T: 238  G: 233  C: 227

Fasta

 

>yahB E. coli K12. Version NC_000913.3 GI:556503834
atgaactcaatttttaccgaagagaatctgttggcatttactaccgctgcgcgttttggc
agcttcagtaaagccgcagaagagttgggtttaaccacttccgccattagctacaccatt
aagcgtatggagacggggctggatgtggtgctgttcactcgcagtacccgcagcattgag
ttaacggagtccgggcgttattttttccgcaaagctaccgacctgctgaatgatttttat
gccatcaaacgcagaatcgatactatttcgcagggcatagaagcgcgtgtgcgcatttgt
attaatcagctgctttatacgcccaaacacaccgcacgcttgttacaggtgctgaaaaag
cagtttcctacctgccagattaccgtcaccaccgaagtgtataacggcgtctgggatgcg
attattaataatcaggccaatatcgccatcggcgcacccgatacactactggacggcggc
ggtattgattacactgaaattggcgcgattcgctgggcttttgctatcgccccggatcac
ccgttagcctttgtgccggaacccatcgccgaaagccaactgcgtctctaccctaatatt
atggtggaggacaccgcgcatacgattaataaaaaagtgggctggttgctgcacgggcag
gagtcaattctggtgccagatttcaacaccaaatgtcagtgccagattttaggtgaagga
attggttttttgccggattacatggtccgtgaggcgatgacgcaatccctgctggttacc
cgacaaatccataatccgcgccaggattcgcgcatgttactggcgactcagcattctgct
acgggtcaggtgacgcagtggattaaaaaacaatttgcgccaaatggcatattaacgggg
atctatcaggatttactgcatcgggagaattaa
              
                            

Download fasta file
RegulonDB