RegulonDB RegulonDB 10.8: Gene Sequence
yaiP gene sequence


Size: 1197        A: 260  T: 339  G: 315  C: 283

Fasta

 

>yaiP E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacctggatatttatctgtatgtccatagcaatgttgctatggtttttaagtacg
ctaagacgtaaacccagtcaaaagaaaggctgtattgacgccattatacctgcgtataac
gaaggcccgtgtctggcgcagtcactggataatctactgcgtaacccttatttttgccgg
gtaatttgcgttaacgacggctccacggacaataccgaagcggtcatggcggaagtcaaa
cgcaaatggggcgaccgctttgttgccgtcacgcaaaaaaataccggtaaaggtggtgcg
ctgatgaatggcctcaattacgccacctgcgaccaggtttttttaagtgatgccgacacc
tatgttccgcccgatcaagacggaatgggctatatgctggcagaaattgagcgcggtgcc
gatgccgtaggcggcattccctctactgcgttgaaaggcgcgggtctgttaccgcacatc
cgcgcgaccgtaaagttgccgatgattgttatgaagcgcacgctacagcagctcctgggt
ggcgcaccgtttattatcagcggtgcctgcgggatgttccgtactgatgtattgcgtaag
ttcggtttctcggatcgtactaaagtcgaagaccttgatctcacctggacattggtggca
aacggctaccgtattcggcaggcgaatcgctgcatcgtatacccacaggaatgcaacagc
ccgcgtgaggagtggcgtcgctggcggcgttggattgtgggatacgcggtctgtatgcgc
ctgcataaaagacttttatttagccgcttcggtatcttcagtatatttcctatgctgttg
gttgtgctttatggcgttgggatttatctcactacctggtttaatgaattcatcaccacc
gggccgcatggagtggtgttggcaatgtttccgcttatctgggtcggcgtagtttgtgtt
attggtgcttttagcgcctggtttcatcgttgctggttgttggtgcctttagcgccgctt
tccgttgtgtatgtattattagcttatgccatctggattatttatggacttattgccttt
tttactggacgcgaacctcagcgcgacaaacccacccgctattccgcactggtggaagcg
tcaaccgcttattcccaaccttctgtcacaggaactgaaaaactatctgaagcttaa
              
                            

Download fasta file
RegulonDB