RegulonDB RegulonDB 10.8: Gene Sequence
proY gene sequence


Size: 1374        A: 265  T: 382  G: 399  C: 328

Fasta

 

>proY E. coli K12. Version NC_000913.3 GI:556503834
atggaaagtaagaacaagctaaagcgtgggctaagtacccgccacatacgctttatggca
ctgggttcagcaattggcaccgggctgttttacggttcggcagacgccatcaaaatggcc
ggtccgagcgtgttgttggcctatattatcggtggtatcgcggcgtatatcattatgcgt
gcgctgggggaaatgtcggtacataacccggccgccagctctttctcgcgttatgcgcag
gaaaacctcggcccgctggcaggttacattaccggctggacctactgctttgaaatcctt
attgtcgccatcgccgatgtgaccgcttttggtatctatatgggtgtctggttcccgacg
gtgccgcactggatttgggtactgagcgtggtgctgatcatttgcgccgtaaacctgatg
agcgtgaaggtattcggtgagctggaattctggttctcgttctttaaagtcgccaccatc
atcatcatgattgtcgccggtttcggcatcatcatctgggggattggcaacggcgggcaa
ccgaccggtattcataacctgtggagcaacggcggcttcttcagtaacggctggcttggc
atggtaatgtcgttgcaaatggtgatgtttgcttacggtgggatcgaaattatcgggatt
accgccggtgaagcgaaagatcctgagaaatcgataccgcgtgcgattaactccgtgccg
atgcgtattctggtgttctacgtcggtacgctgttcgtcattatgtctatctacccgtgg
aatcaggttggcactgccggtagcccgttcgtgctgacgttccagcatatgggcattacc
tttgccgccagcattcttaactttgttgtgctgactgcttcgctgtcggcaattaacagt
gatgtatttggcgtaggccgtatgctccacggtatggcagagcagggcagcgcgccgaaa
attttcagcaaaacgtcgcgtcgcggtattccgtgggttacggtgctggtgatgactacc
gcgctgctgtttgcggtgtatctgaactacatcatgccggaaaacgtcttcctggtgatc
gcttcgctggcaaccttcgccacggtgtgggtgtggattatgatcctgctgtcgcaaatt
gccttccgtcgccgtttgccgccagaagaagttaaggcgctgaaatttaaagtgccgggt
ggggtagcaacgaccatcggcgggctgattttcctgctctttattatcgggttgattggt
tatcacccggatacgcgtatctcgctgtatgtcggtttcgcgtggattgttgtgctgttg
attggctggatgtttaaacgccgccacgatcgtcagctggctgaaaaccagtaa
              
                            

Download fasta file
RegulonDB