RegulonDB RegulonDB 10.8: Gene Sequence
thiL gene sequence


Size: 978        A: 196  T: 250  G: 278  C: 254

Fasta

 

>thiL E. coli K12. Version NC_000913.3 GI:556503834
atggcatgtggcgagttctccctgattgcccgttattttgaccgtgtaagaagttctcgt
cttgatgtcgaactgggcatcggcgacgattgcgcacttctcaatatccccgagaaacag
accctggcgatcagcactgatacgctggtggcgggtaaccatttcctccctgatatcgat
cctgctgatctggcttataaagcactggcggtgaacctaagcgatctggcagcgatgggg
gccgatccggcctggctgacgctggcattaaccttaccggacgtagacgaagcgtggctt
gagtccttcagcgacagtttgtttgatcttctcaattattacgatatgcaactcattggc
ggcgataccacgcgtgggccattatcaatgacgttgggtatccacggctttgttccgatg
ggacgagccttaacgcgctctggggcgaaaccgggtgactggatctatgtgaccggtaca
ccgggcgatagcgccgccgggctggcgattttgcaaaaccgtttgcaggttgccgatgct
aaagatgcggactacttgatcaaacgtcatctccgtccatcgccgcgtattttacagggg
caggcactgcgcgatctggcaaattcagccatcgatctctctgacggtttgatttccgat
ctcgggcatatcgtgaaagccagcgactgcggcgcacgtattgacctggcattgctgccg
ttttctgatgcgctttctcgccatgttgaaccggaacaggcgctgcgctgggcgctctct
ggcggtgaagattacgagttgtgtttcactgtgccggaactgaaccgtggcgcgctggat
gtggctctcggacacctgggcgtaccgtttacctgtatcgggcaaatgaccgccgatatc
gaagggctttgttttattcgtgacggcgaacctgttacattagactggaaaggatatgac
cattttgccacgccataa
              
                            

Download fasta file
RegulonDB