RegulonDB RegulonDB 10.8: Gene Sequence
yajO gene sequence


Size: 975        A: 251  T: 207  G: 278  C: 239

Fasta

 

>yajO E. coli K12. Version NC_000913.3 GI:556503834
atgcaatacaaccccttaggaaaaaccgaccttcgcgtttcccgactttgcctcggctgt
atgacctttggcgagccagatcgcggtaatcacgcatggacactgccggaagaaagcagc
cgtcccataattaaacgtgcactggaaggcggcataaatttctttgataccgccaacagt
tattctgacggcagcagcgaagagatcgtcggtcgcgcactgcgggatttcgcccgtcgt
gaagacgtggtcgttgcgaccaaagtgttccatcgcgttggtgatttaccggaaggatta
tcccgtgcgcaaattttgcgctctatcgacgacagcctgcgacgtctcggcatggattat
gtcgatatcctgcaaattcatcgctgggattacaacacgccgatcgaagagacgctggaa
gccctcaacgacgtggtaaaagccgggaaagcgcgttatatcggcgcgtcatcaatgcac
gcttcgcagtttgctcaggcactggaactccaaaaacagcacggctgggcgcagtttgtc
agtatgcaggatcactacaatctgatttatcgtgaagaagagcgcgagatgctaccactg
tgttatcaggagggcgtggcggtaattccatggagcccgctggcaaggggccgtctgacg
cgtccgtggggagaaactaccgcacgactggtgtctgatgaggtggggaaaaatctctat
aaagaaagcgatgaaaatgacgcgcagatcgcagagcggttaacaggcgtcagtgaagaa
ctgggggcgacacgagcacaagttgcgctggcctggttgttgagtaaaccgggcattgcc
gcaccgattatcggaacttcgcgcgaagaacagcttgatgagctattgaacgcggtggat
atcactttgaagccggaacagattgccgaactggaaacgccgtataaaccgcatcctgtc
gtaggatttaaataa
              
                            

Download fasta file
RegulonDB