RegulonDB RegulonDB 10.8: Gene Sequence
dxs gene sequence


Size: 1863        A: 443  T: 409  G: 517  C: 494

Fasta

 

>dxs E. coli K12. Version NC_000913.3 GI:556503834
atgagttttgatattgccaaatacccgaccctggcactggtcgactccacccaggagtta
cgactgttgccgaaagagagtttaccgaaactctgcgacgaactgcgccgctatttactc
gacagcgtgagccgttccagcgggcacttcgcctccgggctgggcacggtcgaactgacc
gtggcgctgcactatgtctacaacaccccgtttgaccaattgatttgggatgtggggcat
caggcttatccgcataaaattttgaccggacgccgcgacaaaatcggcaccatccgtcag
aaaggcggtctgcacccgttcccgtggcgcggcgaaagcgaatatgacgtattaagcgtc
gggcattcatcaacctccatcagtgccggaattggtattgcggttgctgccgaaaaagaa
ggcaaaaatcgccgcaccgtctgtgtcattggcgatggcgcgattaccgcaggcatggcg
tttgaagcgatgaatcacgcgggcgatatccgtcctgatatgctggtgattctcaacgac
aatgaaatgtcgatttccgaaaatgtcggcgcgctcaacaaccatctggcacagctgctt
tccggtaagctttactcttcactgcgcgaaggcgggaaaaaagttttctctggcgtgccg
ccaattaaagagctgctcaaacgcaccgaagaacatattaaaggcatggtagtgcctggc
acgttgtttgaagagctgggctttaactacatcggcccggtggacggtcacgatgtgctg
gggcttatcaccacgctaaagaacatgcgcgacctgaaaggcccgcagttcctgcatatc
atgaccaaaaaaggtcgtggttatgaaccggcagaaaaagacccgatcactttccacgcc
gtgcctaaatttgatccctccagcggttgtttgccgaaaagtagcggcggtttgccgagc
tattcaaaaatctttggcgactggttgtgcgaaacggcagcgaaagacaacaagctgatg
gcgattactccggcgatgcgtgaaggttccggcatggtcgagttttcacgtaaattcccg
gatcgctacttcgacgtggcaattgccgagcaacacgcggtgacctttgctgcgggtctg
gcgattggtgggtacaaacccattgtcgcgatttactccactttcctgcaacgcgcctat
gatcaggtgctgcatgacgtggcgattcaaaagcttccggtcctgttcgccatcgaccgc
gcgggcattgttggtgctgacggtcaaacccatcagggtgcttttgatctctcttacctg
cgctgcataccggaaatggtcattatgaccccgagcgatgaaaacgaatgtcgccagatg
ctctataccggctatcactataacgatggcccgtcagcggtgcgctacccgcgtggcaac
gcggtcggcgtggaactgacgccgctggaaaaactaccaattggcaaaggcattgtgaag
cgtcgtggcgagaaactggcgatccttaactttggtacgctgatgccagaagcggcgaaa
gtcgccgaatcgctgaacgccacgctggtcgatatgcgttttgtgaaaccgcttgatgaa
gcgttaattctggaaatggccgccagccatgaagcgctggtcaccgtagaagaaaacgcc
attatgggcggcgcaggcagcggcgtgaacgaagtgctgatggcccatcgtaaaccagta
cccgtgctgaacattggcctgccggacttctttattccgcaaggaactcaggaagaaatg
cgcgccgaactcggcctcgatgccgctggtatggaagccaaaatcaaggcctggctggca
taa
              
                            

Download fasta file
RegulonDB