RegulonDB RegulonDB 10.8: Gene Sequence
ylbE gene sequence


Size: 1260        A: 273  T: 266  G: 402  C: 319

Fasta

 

>ylbE E. coli K12. Version NC_000913.3 GI:556503834
atgtttacatcagtggcgcaagccaatgctgcggttatcgaacaaattcgtcgcgctcgt
ccacactggctggatgtgcaaccggcttcttcacttatcagcgaactaaacgagggcaaa
acactgcttcacgccgggccgccaatgcgctggcaggagatgaccggacccatgaaaggg
gcgtgcgtgggcgcatgtctgttcgaaggttgggcgaaagatgaagcgcaggcgctggca
atactggagcagggggaagtgaacttcattccttgtcaccatgtgaatgccgtcgggcca
atgggcggtattacttctgccagtatgccgatgctggtggttgagaacgtgaccgacggc
aaccgggcgtactgcaacctcaacgaaggtatcggcaaagtgatgcgttttggcgcttac
ggcgaagatgtcctgactcgccatcgctggatgcgcgatgtgttaatgccagtattaagc
gcggcgctggggcgcatggagcgcggtatcgatctcacggcgatgatggcgcagggcatt
acgatgggcgatgagttccatcaacgcaatattgcttcctctgcactgttaatgcgtgcg
ctggccccacaaattgctcgcctcgatcatgataaacagcacatcgccgaagtgatggat
ttcctcagcgtgaccgatcagttcttcctcaacctcgcgatggcttactgcaaggcggcg
atggatgctggcgcgatgatccgcgcaggcagcatcgtcacggcaatgacccgcaacggc
aatatgttcgggattcgggtaagcgggctgggcgaacgctggtttactgcgcctgtaaac
actccgcaaggtctgtttttcaccggcttctcgcaggagcaggcgaacccggatatgggc
gatagcgcgattaccgaaacctttggtatcggaggtgcggcaatgatcgcagcgcctggc
gtaacgcgctttgtcggtgcgggtggcatggaagcggcaagagcggtatctgaagagatg
gcggaaatttaccttgaacgcaatatgcagttgcagatcccaagctgggattttcagggc
gcgtgcctggggctggacattcgtcgcgtggtagaaaccggcattacgccactcatcaat
accggtatcgcccataaagaggcggggatcgggcagattggcgcaggcaccgtgcgggca
ccgctggcgtgctttgaacaggcgctggaagcactggctgaaagcatgggtattggttga
              
                            

Download fasta file
RegulonDB