RegulonDB RegulonDB 10.8: Gene Sequence
sfmD gene sequence


Size: 2604        A: 652  T: 707  G: 667  C: 578

Fasta

 

>sfmD E. coli K12. Version NC_000913.3 GI:556503834
atgaaaatacccactactacggatattccgcagaggtatacctggtgtctggccggaatt
tgttattcatctcttgccattttaccctcctttttaagctatgcggaaagttatttcaac
ccggcatttttattagagaatggcacatccgttgctgatttatcgcgctttgagagaggt
aatcatcaacctgcgggcgtgtatcgggtggatctctggcgtaatgatgagttcattggt
tcgcaggatatcgtatttgaatcgacaacagaaaatacaggtgataaatcaggtgggtta
atgccctgttttaaccaggtacttcttgaacgaattggccttaatagcagtgcatttccc
gagttagcccagcagcaaaacaataaatgcatcaatttactgaaagctgtacctgatgcc
acaattaactttgattttgcagcgatgcgcctgaacatcactattcctcagatagcgttg
ttgagtagcgctcacggttacattccgcctgaagagtgggatgaaggtattcctgcttta
ctcctgaattataatttcaccggtaacagaggtaatggtaacgatagctatttttttagt
gagctcagcgggattaatattggcccgtggcgtttacgcaacaatggttcctggaactat
tttcgcggaaatggatatcattcagaacagtggaataatattggcacctgggtacagcgc
gccattattccgctgaaaagtgaactggtaatgggagacggcaatacaggaagtgatatt
ttcgatggcgttggatttcgtggtgtacggctttattcttctgataatatgtatcctgat
agccagcaagggtttgccccaacggtacgtgggattgcccgtacggcggcccagctaacg
attcggcaaaatggttttattatctatcaaagctatgtttcccccggcgcttttgaaatt
acagatttgcacccgacatcttcaaatggcgatctggacgtcaccatcgacgagcgcgat
ggcaatcagcagaattacacaattccgtattcaacagtgccaattttacaacgcgaaggg
cgtttcaaatttgacctgacggcgggcgattttcgtagcggtaatagtcagcaatcatcg
cctttcttttttcagggtacggcactcggcggtttaccacaggaatttactgcctacggc
gggacgcaattatctgccaattacaccgcctttttattagggctggggcgcaatctcggg
aactggggcgcagtgtcgctggatgtaacgcatgcgcgcagtcagttagccgacgccagt
cgtcatgagggggattctattcgcttcctctatgcgaaatcgatgaacaccttcggcacc
aattttcagttaatgggttaccgctattcgacacaaggtttttatacccttgatgatgtt
gcgtatcgtcgaatggaggggtacgaatatgattacgacggtgagcatcgcgatgaaccg
ataatcgtgaattaccacaatttacgctttagccgtaaagaccgtttgcagttaaatgtt
tcacaatcacttaatgactttggctcgctttatatttctggtacccatcaaaaatactgg
aatacttcggattcagatacgtggtatcaggtggggtataccagcagctgggttggcatc
agttattcgctctcattttcgtggaatgaatctgtagggatccccgataacgaacgtatt
gtcggacttaatgtttcagtgcctttcaatgttttgaccaaacgtcgctacacccgggaa
aatgcgctcgaccgcgcttatgcctcctttaacgccaaccgtaacagcaacgggcaaaat
agctggctggcaggtgtaggtgggaccttactggaaggccacaacctgagttatcacgta
agccagggtgatacctcgaataatgggtacacgggcagcgccacggcaaactggcaggcc
gcttacggtacgctggggggcgggtataactacgaccgcgatcaacatgacgttaactgg
cagctgtctggcggtgtggtcgggcatgaaaatggcataacgctgagccagcctttaggg
gataccaatgttttgattaaagcgcctggcgcaggcggtgtacgcattgaaaatcaaact
ggcattttaaccgactggcgcggctatgcggtgatgctgtatgccacggtttatcggtat
aaccgtatcgcgcttgataccaatacgatggggaattccatcgatgttgaaaaaaatatt
agcagcgttgtgccgacgcaaggcgcgttggttcgtgccaattttgatacccgcataggc
gtgcgggcgctcattaccgttacccagggcggaaaaccggtgccgtttggatcactggta
cgggaaaacagtaccggaataaccagtatggtgggtgatgacgggcaagtttatttaagt
ggtgcgccattgtctggtgaattactggttcagtggggagacggcgcgaactcacgctgc
attgcgcactatgtattgccgaagcaaagcttacagcaagccgtcactgttatttcggca
gtttgcacacatcctggctcataa
              
                            

Download fasta file
RegulonDB