RegulonDB RegulonDB 10.8: Gene Sequence
rusA gene sequence


Size: 363        A: 94  T: 76  G: 97  C: 96

Fasta

 

>rusA E. coli K12. Version NC_000913.3 GI:556503834
gtgaatacctacagcatcacattaccctggcctccgagcaataatcgctattaccgccat
aatcgcgggcgcacgcacgtcagcgcagaggggcaggcataccgcgataacgtcgcccga
atcattaaaaacgcaatgctggatatcggcctggctatgcctgtgaaaatccgcattgag
tgccacatgccggatcgccgtcgccgtgacctggataatctgcaaaaagccgcttttgac
gcactcactaaagcaggtttctggctggatgatgctcaggtcgttgattaccgcgttgtg
aagatgcctgttaccaaaggtgggaggctggaactgaccatcaccgaaatggggaatgaa
tga
              
                            

Download fasta file
RegulonDB