RegulonDB RegulonDB 10.9: Gene Sequence
cusS gene sequence


Size: 1443        A: 344  T: 348  G: 372  C: 379

Fasta

 

>cusS E. coli K12. Version NC_000913.3 GI:556503834
atggtcagtaagccatttcagcgcccgttttcgctggcaacccgcctgaccttttttatc
agcctggccaccatcgcggcgtttttcgcctttgcatggatcatgatccactcagtaaaa
gttcattttgccgagcaggatattaatgatttaaaagagattagcgccacccttgaacgg
gtactaaatcaccctgacgaaacgcaagcccgacgcttaatgacgctggaagatatcgtc
agtggttattccaatgtgttgatttccctggcagatagtcagggtaaaacggtgtatcac
tcccccggtgcgccggatatccgcgagtttacgcgtgacgccatacccgataaagacgct
cagggtggcgaggtgtatctcctttccggcccgacgatgatgatgccaggccacggtcac
gggcatatggaacacagcaactggcggatgattaacttgccggttggcccgttggtggac
ggcaaaccgatttatacgctctacatcgcgctttcgatcgattttcatcttcattacata
aatgatttgatgaataaacttattatgaccgcatcggtaatcagcatcctgatcgtcttt
atcgtactgttggcggtacataaaggtcacgcgccgatccgcagcgtcagccgtcaaatc
cagaatattacctcgaaagatctcgacgttcgcctcgacccgcagaccgtgcccattgag
ctggaacagctggtactgtcgttcaaccatatgatcgagcgtattgaggatgtctttacc
cgccagtccaatttctcagcggatatcgctcacgaaattcgcacaccaattacgaatctc
ataacgcaaaccgaaatcgccctcagccagtcgcgcagccagaaggagctggaagatgtg
ctctactctaatctcgaagagctgacgcgaatggcgaaaatggtcagcgatatgctgttt
ctcgctcaggccgataacaaccagctaatccccgaaaagaaaatgctcaacctggcggat
gaagtcggcaaagtgttcgattttttcgaggcgttagcggaagatcgcggcgtggagttg
cggtttgttggcgacaagtgtcaggtcgcgggcgatccgctgatgctgcgtcgggcgcta
agcaacctgctttcgaacgccctgcgttatacgccaaccggagagacaattgtagtgcgc
tgtcagacggtcgatcacctggtgcaagttatcgtcgaaaaccccggtacgcccattgcg
cccgagcacttaccgcgattgtttgaccgtttctatcgcgttgacccctcccgccagcga
aaaggtgaaggtagcggtattggcctggcgatagtgaaatcgattgttgtcgcgcataaa
ggcacggttgcggtaacgtcggatgcgcgggggacaaggtttgttatcacattacccgct
taa
              
                            

Download fasta file
RegulonDB