RegulonDB RegulonDB 10.10: Gene Sequence
cusR gene sequence


Size: 684        A: 152  T: 164  G: 207  C: 161

Fasta

 

>cusR E. coli K12. Version NC_000913.3 GI:556503834
atgaaactgttgattgtcgaagatgaaaagaaaaccggagaatacttgaccaaagggtta
accgaagccggttttgtggtcgatttggccgacaacgggctgaatggctaccatctggcg
atgaccggtgattatgatctgataatcctcgatattatgctgccggacgtgaacggctgg
gatatcgtgcgcatgttacgctccgccaataaagggatgccgattctgttgcttaccgcg
cttggcaccattgaacatcgcgtcaaggggctggagttgggggcagatgactacctggtg
aagccattcgcttttgctgaactgctggcgcgggtgcgcacattactgcggcgcggggcg
gcggtgattatcgaaagtcagtttcaggttgccgatttgatggtcgatctcgtcagccgc
aaagtcacccgcagcggcacgcgcatcactttgaccagtaaagagtttactctgctggag
ttcttccttcgccatcagggcgaagtgctgccccgctcgcttatcgcctcgcaggtatgg
gacatgaattttgacagcgataccaatgctattgatgtggcggtgaagcggctgcgcggc
aaaatcgacaacgactttgagccgaagctaattcagaccgtgcgcggcgtgggttacatg
cttgaggtgccggatggtcagtaa
              
                            

Download fasta file
RegulonDB