RegulonDB RegulonDB 10.10: Gene Sequence
cusC gene sequence


Size: 1374        A: 352  T: 318  G: 368  C: 336

Fasta

 

>cusC E. coli K12. Version NC_000913.3 GI:556503834
atgtctccttgtaaacttctgccattttgtgtggcccttgcgctaaccggttgttcactg
gcaccggattatcagcgtccggcaatgcccgtgccgcagcagttctcactcagccagaac
ggcctggttaacgcagcagataactatcagaacgcgggctggcgcaccttttttgttgat
aatcaggtgaagacgctgattagcgaggcgctggtgaataatcgggatttgcgcatggcg
acgctgaaagtgcaggaggcacgggcgcaatatcgtctgaccgatgccgaccgctaccca
cagctcaatggcgagggcagcggcagctggagcggtaatcttaaagggaataccgccacg
acacgggagttttcgaccggccttaacgccagctttgacctcgattttttcggtcgctta
aagaacatgagcgaagccgagcgacaaaattatttagccactgaggaagctcagcgcgcg
gtgcatattctgctggtttctaatgtcgcgcaaagctatttcaatcagcaactggcgtat
gcgcaattgcaaatagccgaagaaacgctgcgtaattatcagcagtcatatgcgtttgtc
gaaaaacaactgttgacaggtagcagtaatgttctggcgctggaacaggctcgcggggtg
atagaaagtacccgcagcgacatcgctaaacgtcagggggaactggcgcaggcgaataat
gcattgcaactgttgctgggaagctacggcaagctgccgcaagcgcagacagtaaacagc
gacagcctgcaaagcgttaaattaccggcgggattgtcgtcgcaaatcttattgcagcgc
ccggatattatggaagctgaacacgcgttaatggcggctaatgccaatattggcgctgca
cgcgcggcattttttccgtctataagcctgaccagcggaatatcgaccgccagtagcgat
ctatcgtcattatttaacgccagcagcgggatgtggaattttatacccaaaattgagatc
cccatttttaatgccggacgcaaccaggccaatctggatatcgccgaaattcgccagcag
cagtcggtggtgaattatgaacagaaaatccagaacgcctttaaagaagtggcagatgcg
ctggcattacgtcaaagcctgaacgatcaaattagcgcccagcagcgttatctggcatcg
ctgcaaattactttgcaacgggcgcgggcattatatcagcacggcgcagtaagttatctg
gaagtgctggatgccgagcgttctttatttgcaacccgacaaactttacttgatctgaat
tatgcccgtcaggttaacgaaatttctttgtataccgcacttggtggcggttga
              
                            

Download fasta file
RegulonDB