RegulonDB RegulonDB 10.10: Gene Sequence
cusF gene sequence


Size: 333        A: 106  T: 76  G: 73  C: 78

Fasta

 

>cusF E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaagcactgcaagtcgcaatgttcagtctgtttaccgttattggctttaatgcc
caggctaacgaacatcatcatgaaaccatgagcgaagcacaaccacaggttattagcgcc
actggcgtggtaaagggtatcgatctggaaagcaaaaaaatcaccatccatcacgatccg
attgctgccgtgaactggccggagatgaccatgcgctttaccatcaccccgcagacgaaa
atgagtgaaattaaaaccggcgacaaagtggcgtttaattttgtccagcagggcaacctt
tctttattacaggatattaaagtcagccagtaa
              
                            

Download fasta file
RegulonDB