RegulonDB RegulonDB 10.8: Gene Sequence
cusB gene sequence


Size: 1224        A: 282  T: 260  G: 353  C: 329

Fasta

 

>cusB E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaaatcgcgcttattatcggcagcatgatcgcgggcggtattatttctgcggca
ggttttacctgggttgcaaaggcggaaccgcctgcagaaaaaacgtcgaccgcagaacgt
aaaatcttattctggtacgacccaatgtatcccaatacgcggttcgataaaccaggtaaa
tcgccgtttatggatatggatctggtgccgaaatatgccgatgaagagagttctgcgtct
ggtgtgcgcattgacccgactcagacgcagaatctgggggtgaaaacggctaccgtcacg
cgcggaccgctgacttttgcccagagtttcccggcgaatgtcagttacaacgagtatcag
tatgccattgtgcaggctcgcgctgccgggtttatcgacaaggtgtatccgcttaccgtg
ggcgataaagtacaaaagggcacaccgcttctcgacctgaccattcctgactgggtggaa
gcgcagagtgagtatttactgctgcgcgaaaccggcggtacggcgacccagactgaaggc
attcttgagcggctgcgactggcgggaatgccggaggcggatattcgccgcctgatcgcc
acgcaaaaaatccagactcgctttacgctcaaagcgcccattgatggcgtgatcaccgcg
tttgatctgcgcgcgggaatgaatatcgccaaagataacgtggtagcgaaaattcagggt
atggacccggtgtgggtcactgctgcgatcccggagtctatcgcctggctggtgaaagat
gcctcgcagtttaccctcaccgttccggcgcgaccggataaaacactcaccatccgcaaa
tggacgctgctacctggcgtggatgccgcgacccgcacgctgcagctgcgtctggaagtc
gacaacgccgacgaggcgctaaaaccgggcatgaacgcctggttgcaactcaacaccgcc
agcgaaccgatgctgctcattccgtcacaagcgctgattgataccggcagcgaacagcgg
gtgattaccgttgatgccgacgggcgctttgtaccgaaacgcgttgctgttttccaggca
tcgcaaggcgtcaccgcattacgctctggtctggcggaaggtgaaaaggtggtttccagc
ggcctgttcctgattgattccgaagccaatatttctggcgcactggagcggatgcgctct
gaaagtgctacccatgcgcattga
              
                            

Download fasta file
RegulonDB