RegulonDB RegulonDB 10.8: Gene Sequence
ybdG gene sequence


Size: 1248        A: 297  T: 358  G: 319  C: 274

Fasta

 

>ybdG E. coli K12. Version NC_000913.3 GI:556503834
atgcaggatttaatatcccaggttgaagatttagcgggtattgagatcgatcacaccacc
tcgatggtgatgattttcggtattatttttctgaccgccgtcgtggtgcatattattttg
cattgggtggtactgcggaccttcgaaaaacgtgccatcgccagttcacggctttggttg
caaatcattacccagaataaactcttccaccgtttagcttttaccctgcaggggattatc
gtcaatattcaggcggtattctggctgcaaaaaggcaccgaagcggcagatattctgact
acctgcgcgcagttgtggatcatgatgtatgcgctgctttcagtcttctcgttgctggat
gttattttgaatctggcgcagaaattcccggcagcatctcagttaccgctgaaagggata
tttcaggggattaaactgatcggcgcgattctggtcggcattttgatgatctcgctgctg
attggtcagtcgccagcgattctgatcagcggtcttggtgcaatggctgccgtgctgatg
ttggtatttaaagatccgattcttggtctggtggcaggtattcagctttccgcgaacgat
atgctgaaactgggcgactggctggagatgccgaaatacggcgcggatggcgcggtgatc
gatattgggttaaccaccgtcaaagtgcgtaactgggacaataccattaccactattccc
acctggtctctggtttctgactcctttaaaaactggagcgggatgtcagcatctggcggg
cgacgtattaagcgcagtatcagtattgatgtcaccagtattcgttttcttgatgaagac
gaaatgcaacgtctgaataaagcgcatttgttaaagccttatttaaccagccgccatcag
gaaattaatgagtggaatcgccagcaaggttctacggagtcggtattaaatctgcgccga
atgaccaatattggaacctttcgtgcctatctgaacgaatatctgcgtaaccatccgcgg
attcgtaaagatatgaccttaatggtacgccaactggctccaggtgataacggtttaccg
ctcgagatctacgcgtttactaacaccgtggtgtggctggaatatgaaagcattcaggct
gatatattcgatcacatatttgcgattgtcgaagagtttggtctgcgacttcatcagtcg
ccaaccggcaatgatattcgctctctggcgggtgcatttaagcagtaa
              
                            

Download fasta file
RegulonDB