RegulonDB RegulonDB 10.9: Gene Sequence
dsbG gene sequence


Size: 747        A: 235  T: 162  G: 180  C: 170

Fasta

 

>dsbG E. coli K12. Version NC_000913.3 GI:556503834
atgttaaaaaagatacttttactggctctgcttcctgcaatcgccttcgcagaggaactt
cctgctccagtaaaagcgattgaaaaacagggcattacaatcatcaaaacattcgatgcc
cccggaggaatgaaaggttatctcggaaagtatcaggatatgggcgtcaccatctacctg
actccagatggtaagcacgctatctctggttacatgtacaacgagaaaggtgaaaacctg
agtaacacacttatcgaaaaagaaatttacgcaccagccggacgcgaaatgtggcaacgg
atggaacaatcccactggctcctcgacggtaaaaaagatgcgccggtcattgtctacgtc
ttcgccgatccgttctgcccatattgtaaacagttctggcagcaggcgcgcccgtgggta
gattctggcaaagtgcaattaagaacattgttggttggggttatcaagccagaaagcccg
gcgacagcagcggcaattcttgcctccaaagatcccgcaaaaacctggcaacaatatgaa
gcctctggtggcaagcttaagctaaacgtgcctgcaaacgtaagtacagagcaaatgaaa
gtgttaagtgacaatgagaaactgatggacgatctgggggcaaatgtcacgccggctatc
tattacatgagtaaggaaaatacgctacaacaggccgtggggttgcccgatcagaaaacg
cttaatatcattatggggaataaataa
              
                            

Download fasta file
RegulonDB