RegulonDB RegulonDB 10.8: Gene Sequence
citF gene sequence


Size: 1533        A: 333  T: 336  G: 431  C: 433

Fasta

 

>citF E. coli K12. Version NC_000913.3 GI:556503834
atgacgcagaaaattgaacaatctcaacgacaagaacgggtagcggcctggaatcgtcgc
gctgaatgcgatcttgccgctttccagaactcgccaaagcaaacctaccaggctgaaaaa
gcgcgcgatcgcaaactgtgcgccaacctggaagaagcgattcgtcgctctggtttacag
gacggcatgacggtttccttccatcacgctttccgtggcggtgacctgaccgtcaatatg
gtgatggacgtcatcgcgaagatgggctttaaaaacctgaccctggcgtccagctccctg
agtgattgccatgcgccgctggtagaacacattcgccagggcgtggttacccgcatttat
acctccggcctgcgtggtccactggcggaagagatctcccgtggtctgctggcagaaccg
gtgcagatccactctcacggcggtcgtgtgcatctggtacagagcggcgaactgaatatc
gacgtggctttcctcggcgtcccgtcctgtgatgaattcggtaatgccaacggctacacc
ggtaaagcctgctgcggctccctcggctatgcaatagttgatgccgacaacgcaaaacag
gtcgtgatgcttaccgaagaactgctgccttatccgcataatccggcaagcattgagcaa
gatcaggttgatttgatcgtcaaagttgaccgcgttggcgatgctgcaaaaatcggcgct
ggcgcgacccgtatgaccactaacccgcgcgaactgcttattgcccgtagcgctgcggat
gtgattgtcaactctggctacttcaaagaaggtttctccatgcaaaccggcaccggcggc
gcatcgctggcggtaacccgtttcctggaagacaaaatgcgtagccgcgatattcgcgcc
gacttcgcccttggcggtattaccgcgacgatggttgacctgcacgaaaaaggtctgatc
cgcaaactgctggatgtgcagagctttgacagccatgctgcgcaatcgctggcccgtaac
cccaatcacatcgaaatcagcgccaaccagtacgctaactggggttcgaaaggcgcatcg
gttgatcgtctcgacgtggtggtactgagcgcgctggaaattgacacccagttcaacgtt
aacgtgctgaccggctctgacggcgtactgcgtggtgcttccggtggtcactgcgatacc
gcgattgcctctgcgctttccatcatcgtcgcgccgctggtacgcggtcgtattccgact
ctggtggataacgtactgacctgcatcaccccaggctccagtgtcgatattctggtcaca
gaccacggtatcgcagttaacccggcacgtccggaactggcagaacgtctgcaggaagcg
ggcattaaagtggtttccattgagtggctgcgcgaacgtgcgcgtctgctgaccggtgaa
ccacagccgattgaattcacagaccgcgtcgttgccgttgtgcgttaccgcgatggctcg
gtgatcgatgttgtgcatcaggtgaaggaataa
              
                            

Download fasta file
RegulonDB